hsa-miR-425-3p miRNA Inhibitor

Properties Quality level: 100 Product line: MISSION® Mature sequence: AUCGGGAAUGUCGUGUCCGCCC Sanger no. Mature/minor accession: MIMAT0001343 Sanger microRNA accession number: MI0001448 Storage temperature: −20 ° C General description The individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr Hideo […]

Liferiver

Product details Writes: RT-qPCR Description Liferiver Novel Coronavirus (2019-nCoV) Real-Time Multiplex RT-PCR Kit is a TGA approved in vitro diagnostic (IVD) test kit. The kit is based on real-time RT-PCR technology for the qualitative detection of SARS-CoV-2 specific RNA. The assay includes a positive control and internal control. The kit simultaneously measures 3 target genes […]