Skip to contentSkip to content
Citología y Biografía de Los biólogos españoles

Citología y Biografía de Los biólogos españoles

Anatomía Patológica de Microorganismos, IHC histochemistry

  • Home
  • Blog
  • Chemical
  • Chicken
  • Donkey
  • Feline
  • Goat
  • Guinea
  • Hamster
  • Mouse
  • Lizard
  • Listeria
  • Leech
  • Plant
  • Llama
  • array
  • Macaw
  • Contact Us
  • Distributors
Close Button

hsa-miR-425-3p miRNA Inhibitorhsa-miR-425-3p miRNA Inhibitor

| PedroPedro | 0 Comment

Properties Quality level: 100 Product line: MISSION® Mature sequence: AUCGGGAAUGUCGUGUCCGCCC Sanger no. Mature/minor accession: MIMAT0001343 Sanger microRNA accession number: MI0001448 Storage temperature: −20 ° C General description The individual synthetic

READ MOREREAD MORE

LiferiverLiferiver

| PedroPedro | 0 Comment

Product details Writes: RT-qPCR Description Liferiver Novel Coronavirus (2019-nCoV) Real-Time Multiplex RT-PCR Kit is a TGA approved in vitro diagnostic (IVD) test kit. The kit is based on real-time RT-PCR

READ MOREREAD MORE

Plant Cell TechnologyPlant Cell Technology

| PedroPedro | 0 Comment

What’s Inside The PCT Start Kit? Are you interested in tissue culture but not sure where to start? The PCT Starter Kit is a PERFECT opportunity for you to test

READ MOREREAD MORE

Posts pagination

Previous page Page 1 … Page 7 Page 8
Citología y Biografía de Los biólogos españoles

Recent Posts

  • Abcam alternatives of Lab monoclonals
  • Compare Assays lab reagents for research
  • Compare antibodies lab reagents for research
  • Compare ELISA lab reagents for research
  • Compare recombinant lab reagents for research

Categories

  • array
  • Blog
  • caspase 3 7
  • Chemical
  • Chicken
  • covid antigen rapid test
  • Donkey
  • Feline
  • Goat
  • Guinea
  • gzma
  • Hamster
  • hrp mn
  • Leech
  • Listeria
  • Lizard
  • Llama
  • Macaw
  • mef biology
  • monospecific antibody
  • Mouse
  • pge2 elisa
  • Plant
  • protein carbonyls

Tags

ahr antibody bap1 antibody cell lysis buffer for western blot dialyzed fetal bovine serum dna ancestry dna hr block dna hrblock login dna painter dna tests doublecortin antibody egf elisa elisa test kit fast western blot fetal bovine serum fbs fgfr1 antibody foxo4 antibody fto antibody gadd34 antibody gel electrophoresis equipment list glp1 elisa glut2 antibody goat anti mouse igg hrp human recombinant insulin iba1 antibody wako ihc kit in vitro translation kit keratinocyte serum free medium live cell staining luciferase kit nox1 antibody nupage transfer buffer recipe pan caspase inhibitor pcdna3.1+ peptides for bodybuilding purify antibody purifying antibody qpcr mastermix qubit hs dna rbpj antibody recombinant human tnf alpha sirna transfection reagent transfection reagent vwf elisa western blot loading control western blot sponge

Categories

  • array
  • Blog
  • caspase 3 7
  • Chemical
  • Chicken
  • covid antigen rapid test
  • Donkey
  • Feline
  • Goat
  • Guinea
  • gzma
  • Hamster
  • hrp mn
  • Leech
  • Listeria
  • Lizard
  • Llama
  • Macaw
  • mef biology
  • monospecific antibody
  • Mouse
  • pge2 elisa
  • Plant
  • protein carbonyls

Recent Posts

  • Abcam alternatives of Lab monoclonals
  • Compare Assays lab reagents for research
  • Compare antibodies lab reagents for research
  • Compare ELISA lab reagents for research
  • Compare recombinant lab reagents for research

Quick Links

  • Contact Us
  • Distributors

Software Agency WordPress Theme | Copyright © 2021

Scroll Up