Dual roles of WISP2 in the progression of hepatocellular carcinoma: implications of the fibroblast infiltration into the tumor microenvironment

Dual roles of WISP2 in the progression of hepatocellular carcinoma: implications of the fibroblast infiltration into the tumor microenvironment post thumbnail image
The dismal final result of hepatocellular carcinoma (HCC) sufferers is attributable to excessive frequency of metastasis and. Identification of efficient biomarkers is a key technique to tell prognosis and enhance survival. Earlier research reported inconsistent roles of WISP2 in carcinogenesis, whereas the function of WISP2 in HCC development additionally stays unclear.
On this research, we confirmed that WISP2 was downregulated in HCC tissues, and WISP2 was appearing as a protecting issue, particularly in sufferers with out alcohol consumption utilizing a number of on-line datasets. As well as, we reported that upregulation of WISP2 in HCC was associated to inhibition of the malignant phenotype in vitro, however these alterations weren’t noticed in vivo.
WISP2 additionally negatively correlated with tumour purity, and elevated infiltration of fibroblasts promoted malignant development in HCC tissues. The improved infiltration skill of fibroblasts was associated to upregulated HMGB1 after overexpression of WISP2 in HCC.
The findings make clear the anticancer function of WISP2, and HMGB1 is without doubt one of the key elements concerned within the inhibition of the effectivity of WISP2 by means of decreasing the tumour purity with fibroblast infiltration.

Matricellular protein WISP2 is an endogenous inhibitor of collagen linearization and most cancers metastasis

Collagen transforming contributes to many physiological and pathological processes. In major tumors, the linearization of collagen fibers promotes most cancers cell invasion and metastasis and is indicative of poor prognosis. Nevertheless, it stays unknown whether or not there are endogenous inhibitors of collagen linearization that may very well be exploited therapeutically.
Right here, we present that collagen linearization is managed by two secreted matricellular proteins with antagonistic features. Particularly, WISP1 was secreted by most cancers cells, certain to sort I collagen (Col I), and linearized Col I by way of its cysteine-rich C-terminal (CT) area. In distinction, WISP2, which lacks a CT area, inhibited Col I linearization by stopping WISP1-Col I binding.
Evaluation of affected person information revealed that WISP2 expression is decrease in most strong tumors, compared to regular tissues. Consequently, genetic or pharmacological restoration of upper WISP2 ranges impaired collagen linearization and prevented tumor cell invasion and metastasis in vivo in fashions of human and murine breast most cancers.
Thus, this research uncovers WISP2 as the primary inhibitor of collagen linearization ever recognized and divulges that collagen structure could be normalized and metastasis inhibited by therapeutically restoring a excessive WISP2:WISP1 ratio.

LncRNA SNHG14 promotes osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by way of regulating miR-185-5p/WISP2 axis

Osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) is important for bone formation, and its dysfunction is linked to osteoporosis (OP). On this work, we explored the operate of lengthy non-coding RNA (lncRNA) small nucleolar RNA host gene 14 (SNHG14) in regulating osteogenic differentiation of hBMSCs.
Within the current research, the expression of SNHG14 in hBMSCs obtained from OP sufferers was measured by quantitative real-time polymerase chain response (qRT-PCR). SNHG14 was over-expressed or knocked down in hBMSCs, and the expression ranges of OP-related genes (ALP, OCN, and OPN) in hBMSCs had been detected by qRT-PCR and Western blot.
StarBase database and miRanda database had been used to foretell the binding websites between SNHG14 and miR-185-5p, and between miR-185-5p and three’UTR of WNT1 inducible signaling pathway protein 2 (WISP2), respectively. Luciferase reporter gene assay was used to validate the binding relationship between SNHG14 and miR-185-5p, and miR-185-5p and three’UTR of WISP2, respectively.
Right here, we report that SNHG14 was considerably down-regulated in hBMSCs obtained from sufferers with OP. Overexpression of SNHG14 promoted osteogenic differentiation, whereas knockdown of SNHG14 labored oppositely. Mechanistically, miR-185-5p was demonstrated to be a goal of SNHG14, and will reverse the operate of SNHG14.
Moreover, WISP2 was recognized as a goal gene of miR-185-5p in hBMSCs and may very well be not directly regulated by SNHG14. Taken collectively, down-regulation of SNHG14 in hBMSCs accelerated the development of OP by way of regulating miR-185-5p/WISP2 axis.

Lack of WISP2/CCN5 in estrogen-dependent MCF7 human breast most cancers cells promotes a stem-like cell phenotype.

It has been proposed that the epithelial-mesenchymal transition (EMT) in mammary epithelial cells and breast most cancers cells generates stem cell options. WISP2 (Wnt-1-induced signaling protein-2) performs an essential function in upkeep of the differentiated phenotype of estrogen receptor-positive breast most cancers cells and lack of WISP2 is related to EMT.
We now report that lack of WISP2 in MCF7 breast most cancers cells may also promote the emergence of a most cancers stem-like cell phenotype characterised by excessive expression of CD44, elevated aldehyde dehydrogenase exercise and mammosphere formation. Larger ranges of the stem cell markers Nanog and Oct3/four had been noticed in these mammospheres.
As well as we present that low-cell inoculums are able to tumor formation within the mammary fats pad of immunodeficient mice. Gene expression evaluation present an enrichment of markers linked to stem cell operate reminiscent of SOX9 and IGFBP7 which is linked to TGF-β inducible, SMAD3-dependent transcription. Taken collectively, our information reveal that WISP2 loss promotes each EMT and the stem-like cell phenotype.
 Dual roles of WISP2 in the progression of hepatocellular carcinoma: implications of the fibroblast infiltration into the tumor microenvironment

The Novel Secreted Adipokine WNT1-inducible Signaling Pathway Protein 2 (WISP2) Is a Mesenchymal Cell Activator of Canonical WNT.

WNT1-inducible-signaling pathway protein 2 (WISP2) is primarily expressed in mesenchymal stem cells, fibroblasts, and adipogenic precursor cells. It’s each a secreted and cytosolic protein, the latter regulating precursor cell adipogenic dedication and PPARγ induction by BMP4.
To look at the impact of the secreted protein, we expressed a full-length and a truncated, non-secreted WISP2 in NIH3T3 fibroblasts. Secreted, however not truncated WISP2 activated the canonical WNT pathway with elevated β-catenin ranges, its nuclear concentrating on phosphorylation, and LRP5/6 phosphorylation. It additionally inhibited Pparg activation and the impact of secreted WISP2 was reversed by the WNT antagonist DICKKOPF-1.

Human WNT1 Inducible Signaling Pathway Protein 2 (WISP2) ELISA Kit

RD-WISP2-Hu-48Tests 48 Tests
EUR 521

Human WNT1 Inducible Signaling Pathway Protein 2 (WISP2) ELISA Kit

RD-WISP2-Hu-96Tests 96 Tests
EUR 723

WISP2 antibody

20R-2783 50 ug
EUR 281
Description: Rabbit polyclonal WISP2 antibody

WISP2 Antibody

21668-100ul 100ul
EUR 252

WISP2 Antibody

21668-50ul 50ul
EUR 187

WISP2 Antibody

43815-100ul 100ul
EUR 252

WISP2 Antibody

CSB-PA968927-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against WISP2. Recognizes WISP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

WISP2 Antibody

CSB-PA968927-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against WISP2. Recognizes WISP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

WISP2 Antibody

1-CSB-PA026120ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against WISP2. Recognizes WISP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

WISP2 siRNA

20-abx906090
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WISP2 siRNA

20-abx939863
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WISP2 siRNA

20-abx939864
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-WISP2

YF-PA15907 50 ug
EUR 363
Description: Mouse polyclonal to WISP2

anti-WISP2

YF-PA15908 100 ul
EUR 403
Description: Rabbit polyclonal to WISP2

anti-WISP2

YF-PA27094 50 ul
EUR 363
Description: Mouse polyclonal to WISP2

WISP2 Rabbit pAb

A12541-100ul 100 ul
EUR 308

WISP2 Rabbit pAb

A12541-200ul 200 ul
EUR 459

WISP2 Rabbit pAb

A12541-20ul 20 ul
EUR 183

WISP2 Rabbit pAb

A12541-50ul 50 ul
EUR 223

Anti-WISP2 Antibody

A04480 100ul
EUR 397
Description: Rabbit Polyclonal WISP2 Antibody. Validated in WB and tested in Human.

WISP2 Conjugated Antibody

C43815 100ul
EUR 397

WISP2 cloning plasmid

CSB-CL026120HU1-10ug 10ug
EUR 321
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atgagaggcacaccgaagacccacctcctggccttctccctcctctgcctcctctcaaaggtgcgtacccagctgtgcccgacaccatgtacctgcccctggccacctccccgatgcccgctgggagtacccctggtgctggatggctgtggctgctgccgggtatgtgcacggcg
  • Show more
Description: A cloning plasmid for the WISP2 gene.

WISP2 cloning plasmid

CSB-CL026120HU2-10ug 10ug
EUR 321
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atgagaggcacaccgaagacccacctcctggccttctccctcctctgcctcctctcaaaggtgcgtacccagctgtgcccgacaccatgtacctgcccctggccacctccccgatgcccgctgggagtacccctggtgctggatggctgtggctgctgccgggtatgtgcacggcg
  • Show more
Description: A cloning plasmid for the WISP2 gene.

WISP2 cloning plasmid

CSB-CL026120HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgagaggcacaccgaagacccacctcctggccttctccctcctctgcctcctctcaaaggtgcgtacccagctgtgcccgacaccatgtacctgcccctggccacctccccgatgcccgctgggagtacccctggtgctggatggctgtggctgctgccgggtatgtgcacggcg
  • Show more
Description: A cloning plasmid for the WISP2 gene.

WISP2 Rabbit pAb

A7456-100ul 100 ul
EUR 308

WISP2 Rabbit pAb

A7456-200ul 200 ul
EUR 459

WISP2 Rabbit pAb

A7456-20ul 20 ul
EUR 183

WISP2 Rabbit pAb

A7456-50ul 50 ul
EUR 223

Anti-WISP2 antibody

STJ114415 100 µl
EUR 277
Description: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover.

Anti-WISP2 antibody

STJ29592 100 µl
EUR 277
Description: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover.

Anti-WISP2 (1E11)

YF-MA16548 100 ug
EUR 363
Description: Mouse monoclonal to WISP2

Anti-WISP2 (3D10)

YF-MA16549 100 ug
EUR 363
Description: Mouse monoclonal to WISP2

Mouse WISP2 shRNA Plasmid

20-abx973396
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat WISP2 shRNA Plasmid

20-abx985596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human WISP2 shRNA Plasmid

20-abx955835
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Wisp2 ORF Vector (Mouse) (pORF)

ORF061873 1.0 ug DNA
EUR 506

Wisp2 ORF Vector (Rat) (pORF)

ORF079150 1.0 ug DNA
EUR 506

WISP2 ORF Vector (Human) (pORF)

ORF011603 1.0 ug DNA
EUR 95

WISP2 ORF Vector (Human) (pORF)

ORF011604 1.0 ug DNA
EUR 95

WISP2 ORF Vector (Human) (pORF)

ORF011605 1.0 ug DNA
EUR 95

WISP2 ELISA Kit (Human) (OKCD08993)

OKCD08993 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.117ng/mL
Differentiated 3T3-L1 adipose cells had been additionally goal cells the place extracellular WISP2 activated the canonical WNT pathway, inhibited Pparg and related adipose genes and, just like WNT3a, promoted partial dedifferentiation of the cells and the induction of a myofibroblast phenotype with activation of markers of fibrosis. Thus, WISP2 exerts twin actions in mesenchymal precursor cells; secreted WISP2 prompts canonical WNT and maintains the cells in an undifferentiated state, whereas cytosolic WISP2 regulates adipogenic dedication.

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Post

Pevonedistat and azacitidine upregulate NOXA ( PMAIP1) to increase sensitivity to venetoclax in preclinical models of acute myeloid leukemia

Pevonedistat and azacitidine upregulate NOXA ( PMAIP1) to increase sensitivity to venetoclax in preclinical models of acute myeloid leukemiaPevonedistat and azacitidine upregulate NOXA ( PMAIP1) to increase sensitivity to venetoclax in preclinical models of acute myeloid leukemia

Dysregulation of apoptotic equipment is one mechanism by which acute myeloid leukemia (AML) acquires a clonal survival benefit. B-cell lymphoma protein-2 (BCL2) overexpression is a typical characteristic in hematologic malignancies.