Nieuw middel voor coronapatiënten die zelf geen antistoffen aanmaken

At the Erasmus MC in Rotterdam, the first corona patients have recently been treated with special antibodies. They do not produce enough antibodies on their own, for example, because they use the immunosuppressive medication after a transplant. The hospital itself calls this a breakthrough. The drug, called REGEN-Cov, consists of basiliximab and imdevimab. These are […]

Deltavariant vergroot kans ernstig verloop corona bij zwangere vrouwen

University hospitals are concerned about an increase in the number of pregnant women becoming seriously ill with the delta variant of the coronavirus, reports the Volkskrant. This week, at least five pregnant women with corona were admitted to ICUs. This is the highest number since the beginning of the crisis. In all cases, the women […]

3 misverstanden over de coronavaccins

Since the emergence of the delta variant in our country, there have been many stories circulating about corona vaccines. They say that the vaccines are no longer effective enough against this variant and that many people think they no longer need to meet the crown standards once they have been fully vaccinated. Three misconceptions followed. […]

ChromaFlash Chromatin Extraction Kit

Product description The ChromaFlash ™ Plant Chromatin Extraction Kit is a complete set of buffers and reagents optimized for isolating plant chromatin or DNA-protein complexes in a simple and fast format. Chromatin prepared with this kit can be used in a variety of chromatin immunoprecipitation methods. It is also the recommended method for obtaining the […]

hsa-miR-425-3p miRNA Inhibitor

Properties Quality level: 100 Product line: MISSION® Mature sequence: AUCGGGAAUGUCGUGUCCGCCC Sanger no. Mature/minor accession: MIMAT0001343 Sanger microRNA accession number: MI0001448 Storage temperature: −20 ° C General description The individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr Hideo […]

Liferiver

Product details Writes: RT-qPCR Description Liferiver Novel Coronavirus (2019-nCoV) Real-Time Multiplex RT-PCR Kit is a TGA approved in vitro diagnostic (IVD) test kit. The kit is based on real-time RT-PCR technology for the qualitative detection of SARS-CoV-2 specific RNA. The assay includes a positive control and internal control. The kit simultaneously measures 3 target genes […]