Generation of an induced pluripotent stem cell line from a Bartter syndrome patient with the homozygote mutation p.A244D (c.731C>A) in SLC12A1 gene

Generation of an induced pluripotent stem cell line from a Bartter syndrome patient with the homozygote mutation p.A244D (c.731C>A) in SLC12A1 gene post thumbnail image
Bartter Syndrome (BS) is a gaggle of uncommon inherited autosome-recessive illness, which might be attributable to the gene mutations of sodium-potassium-chloride cotransporter gene (SLC12A1). Right here, the urine cells (UCs) derived from a 4-year-old feminine BS affected person with the homozygote SLC12A1 gene mutation p.
A244D (c.731C>A) had been reprogramming into induced pluripotent stem cells (iPSCs) named WMUi019-A utilizing a business Sendai virus reprogramming equipment. The pluripotent stem cell markers like OCT4 and SSEA4 might be positively expressed on this iPSC line, which will also be induced to distinguish into three germ layers in vitro and preserve a steady karyotype (46, XY).

A protracted-term examine of the consequences of SLC12A1 homozygous mutation (g.62382825G>A, p.Professional372Leu) in Japanese Black cattle

Recessive missense mutation within the solute provider household 12, member 1 (SLC12A1) gene (g.62382825G>A) is related to hydrallantois, which is the buildup of fluid within the allantoic cavity of a pregnant animal, and normally causes fetal demise in Japanese Black cattle.
Nevertheless, the signs of a homozygote with this mutation that don’t lead to fetal demise haven’t beforehand been tracked and evaluated. Within the current examine, we noticed a homozygote with the SLC12A1 threat allele over a long-term interval. The calf didn’t present any apparent scientific signs, though it did exhibit a slight development retardation that accompanied delicate calciuria.
At 28 months of age, the homozygote confirmed renal dysfunction, which in flip resulted in hydronephrosis. The time course of the signs was in keeping with the phenotype of Bartter syndrome in people. Moreover, the danger heterozygous genotype didn’t any results on carcass traits, which signifies that eliminating the danger allele wouldn’t have any unfavorable results.
Subsequently, we emphasize that each the fetal- and late-stage signs related to the SLC12A1 threat allele compromise animal welfare, and consequently might lead to extreme financial losses for particular person farmers if the SLC12A1 threat allele shouldn’t be eradicated from the inhabitants.

A novel SLC12A1 mutation in Bedouin kindred with antenatal Bartter syndrome kind I.

4 affected people of consanguineous kindred introduced at infancy with an apparently autosomal recessive syndrome of polyuria and hypokalemic metabolic alkalosis, following maternal polyhydramnios and untimely supply, culminating in extreme failure to thrive.
Hypercalciuria, nephrocalcinosis, and hyperaldosteronism had been additional obvious in addition to an uncommon discovering of intermittent hypernatremia. Moreover, all sufferers demonstrated variable micrognathia with higher respiratory airway abnormalities.
As neither postnatal hyperkalemia nor everlasting listening to deficits had been proven, scientific evaluation was in keeping with antenatal Bartter syndrome (ABS) kind I, which was by no means described earlier than within the Israeli Bedouin inhabitants.
By way of genome-wide linkage evaluation, we recognized a single ∼3.Three Mbp disease-associated locus on chromosome 15q21.1, segregating throughout the pedigree. Complete-exome sequencing revealed a single novel homozygous missense mutation inside this locus, in SLC12A1, encoding the Na-Ok-Cl cotransporter, NKCC2, in accordance with the scientific prognosis.
On this concise examine, we report a novel missense mutation throughout the SLC12A1 gene, inflicting a extreme type of ABS kind I, the primary to be described in Israeli Bedouins, with uncommon scientific options of hypernatremia attributable to nephrogenic diabetes insipidus and putatively associated micrognathia with higher airway abnormalities .

A missense mutation in solute provider household 12, member 1 (SLC12A1) causes hydrallantois in Japanese Black cattle.

Hydrallantois is the extreme accumulation of fluid throughout the allantoic cavity in pregnant animals and is related to fetal mortality. Though the incidence of hydrallantois could be very low in synthetic insemination breeding packages in cattle, not too long ago 38 cows with the phenotypic look of hydrallantois had been reported in a neighborhood subpopulation of Japanese Black cattle.
Of those, 33 had been traced again to the identical sire; nevertheless, each their dad and mom had been reported wholesome, suggesting that hydrallantois is a recessive inherited dysfunction. To determine autozygous chromosome segments shared by people with hydrallantois and the causative mutation in Japanese Black cattle, we carried out autozygosity mapping utilizing single-nucleotide polymorphism (SNP) array and exome sequencing.

Affiliation of Mutations in SLC12A1 Encoding the NKCC2 Cotransporter With Neonatal Major Hyperparathyroidism.

Major hyperparathyroidism with hypercalciuria has not been described within the new child interval.
Our aims are to determine the genetic foundation for neonatal major hyperparathyroidism in a household with 2 affected kids.
An African American boy presenting with delicate neonatal major hyperparathyroidism and hypercalciuria was evaluated at The Youngsters’s Hospital of Philadelphia. His older brother with neonatal major hyperparathyroidism had died in infancy of a number of organ failure.
We collected scientific and biochemical knowledge and carried out exome sequencing evaluation on DNA from the affected person and his unaffected mom after unfavorable genetic testing for identified causes of major hyperparathyroidism.
Exome sequencing adopted by Sanger sequencing disclosed 2 heterozygous mutations, c.1883C>A, p.(A628D) and c.2786_2787insC, p.(T931fsX10), within the SLC12A1 gene, which was beforehand implicated in antenatal kind 1 Bartter syndrome. Sanger sequencing confirmed the two mutations within the proband and his deceased brother; each dad and mom had been heterozygous for various mutations and an unaffected sister was homozygous for wild-type alleles.
These outcomes show a beforehand unrecognized affiliation between neonatal major hyperparathyroidism and mutation of SLC12A1, the reason for antenatal Bartter syndrome kind 1, and counsel that the lack of sodium-potassium-chloride cotransporter-2 cotransporter exercise influences parathyroid gland operate.
 Generation of an induced pluripotent stem cell line from a Bartter syndrome patient with the homozygote mutation p.A244D (c.731C>A) in SLC12A1 gene

Therapy with an SLC12A1 antagonist inhibits tumorigenesis in a subset of hepatocellular carcinomas.

A central intention in most cancers analysis is to determine genes with altered expression patterns in tumor specimens and their potential position in tumorigenesis. Most sorts of tumors, together with hepatocellular carcinoma (HCC), are heterogeneous when it comes to genotype and phenotype.
Thus, conventional analytical strategies just like the t-test fail to determine all oncogenes from expression profiles. On this examine, we carried out a meta-Most cancers Outlier Profile Evaluation (meta-COPA) throughout six microarray datasets for HCC from the GEO database. We discovered that gene SLC12A1 was overexpressed within the Hep3B cell line, in contrast with 5 different HCC cell traces and L02 cells.

SLC12A1 siRNA

20-abx933510
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLC12A1 Rabbit pAb

A12999-100ul 100 ul
EUR 308

SLC12A1 Rabbit pAb

A12999-200ul 200 ul
EUR 459

SLC12A1 Rabbit pAb

A12999-20ul 20 ul
EUR 183

SLC12A1 Rabbit pAb

A12999-50ul 50 ul
EUR 223

SLC12A1 Blocking Peptide

33R-6671 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC12A1 antibody, catalog no. 70R-3806

SLC12A1 Conjugated Antibody

C35915 100ul
EUR 397

SLC12A1 cloning plasmid

CSB-CL618794HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atgtcactgaacaactcttccaatgtatttctggattcagtgcccagtaataccaatcgctttcaagttagtgtcataaatgagaaccatgagagcagtgcagctgcagatgacaatactgacccaccacattatgaagaaacctcttttggggatgaagctcagaaaagactca
  • Show more
Description: A cloning plasmid for the SLC12A1 gene.

Anti-SLC12A1 Antibody

PA2168 100ug/vial
EUR 334

Anti-SLC12A1 Antibody

PB9392 100ug/vial
EUR 334

pCMV-SPORT6-SLC12A1

PVT18043 2 ug
EUR 231

Anti-SLC12A1 antibody

STJ114968 100 µl
EUR 277
Description: This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.

Anti-SLC12A1 Antibody

STJ501921 100 µg
EUR 476

Anti-SLC12A1 (4H4)

YF-MA15447 100 ug
EUR 363
Description: Mouse monoclonal to SLC12A1

Human SLC12A1 ELISA Kit

ELA-E0312h 96 Tests
EUR 824

SLC12A1 ELISA KIT|Human

EF000555 96 Tests
EUR 689

Mouse SLC12A1 shRNA Plasmid

20-abx972724
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLC12A1 shRNA Plasmid

20-abx954447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-SLC12A1 Antibody BIOTIN

STJ501922 100 µg
EUR 586

Anti-SLC12A1 Antibody FITC

STJ501923 100 µg
EUR 586

Slc12a1 ORF Vector (Rat) (pORF)

ORF076299 1.0 ug DNA
EUR 506

SLC12A1 ORF Vector (Human) (pORF)

ORF009561 1.0 ug DNA
EUR 95
We additionally discovered that the upregulation of SLC12A1 was mediated by histone methylation inside its promoter area, and that SLC12A1 is a optimistic regulator of the WNK1/ERK5 pathway. In keeping with in vitro outcomes, remedy with the SLC12A1 antagonist Bumetanide delayed tumor formation and diminished Hep3B cell tumor measurement in mouse xenografts. In abstract, our analysis reveals a novel subset of HCCs which are delicate to SLC12A1 antagonist remedy, thereby providing a brand new technique for precision HCC remedy.

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Post