Identification of Androgen Receptor Metabolic Correlome Reveals the Repression of Ceramide Kinase by Androgens

Identification of Androgen Receptor Metabolic Correlome Reveals the Repression of Ceramide Kinase by Androgens post thumbnail image
Prostate most cancers (PCa) is likely one of the most prevalent cancers in males. Androgen receptor signaling performs a serious function on this illness, and androgen deprivation remedy is a typical therapeutic technique in recurrent illness.
Sphingolipid metabolism performs a central function in cell demise, survival, and remedy resistance in most cancers. Ceramide kinase (CERK) catalyzes the phosphorylation of ceramide to ceramide 1-phosphate, which regulates varied mobile features together with cell progress and migration. Right here we present that activated androgen receptor (AR) is a repressor of CERK expression.
We undertook a bioinformatics technique utilizing PCa transcriptomics datasets to determine the metabolic alterations related to AR exercise. CERK was among the many most distinguished negatively correlated genes in our evaluation.
Curiously, we demonstrated by means of varied experimental approaches that activated AR reduces the mRNA expression of CERK:
(i) expression of CERK is predominant in cell traces with low or destructive AR exercise;
(ii) AR agonist and antagonist repress and induce CERK mRNA expression, respectively;
(iii) orchiectomy in wildtype mice or mice with PCa (harboring prostate-specific Pten deletion) leads to elevated Cerk mRNA ranges in prostate tissue.
Mechanistically, we discovered that AR represses CERK by means of interplay with its regulatory parts and that the transcriptional repressor EZH2 contributes to this course of. In abstract, we determine a repressive mode of AR that influences the expression of CERK in PCa.

Management of Skeletal Muscle Atrophy Related to Most cancers or Corticosteroids by Ceramide Kinase

Aside from cytokines and chemokines, sphingolipid mediators, significantly sphingosine-1-phosphate (S1P) and ceramide 1-phosphate (C1P), contribute to most cancers and irritation. Most cancers, in addition to different inflammatory situations, are related to skeletal muscle (SkM) atrophy, which is characterised by the unbalance between protein synthesis and degradation.
Though the signaling pathways concerned in SkM mass losing are a number of, the regulatory function of straightforward sphingolipids is proscribed. Right here, we report the impairment of ceramide kinase (CerK), the enzyme answerable for the phosphorylation of ceramide to C1P, related to the accomplishment of atrophic phenotype in varied experimental fashions of SkM atrophy: in vivo animal mannequin bearing the C26 adenocarcinoma or Lewis lung carcinoma tumors, in human and murine SkM cells handled with the conditioned medium obtained from most cancers cells or with the glucocorticoid dexamethasone.
Notably, we display in all of the three experimental approaches a drastic lower of CerK expression. Gene silencing of CerK promotes the up-regulation of atrogin-1/MAFbx expression, which was additionally noticed after cell therapy with C8-ceramide, a biologically energetic ceramide analogue.
Conversely, C1P therapy considerably lowered the corticosteroid’s results. Altogether, these findings present proof that CerK, performing as a molecular modulator, could also be a brand new attainable goal for SkM mass regulation related to most cancers or corticosteroids.

Ceramide Kinase Inhibition Blocks IGF-1-Mediated Survival of Otic Neurosensory Progenitors by Impairing AKT Phosphorylation

Sphingolipids are bioactive lipid parts of cell membranes with necessary sign transduction features in well being and illness. Ceramide is the central constructing block for sphingolipid biosynthesis and is processed to type structurally and functionally distinct sphingolipids.
Ceramide might be phosphorylated by ceramide kinase (CERK) to generate ceramide-1-phosphate, a cytoprotective signaling molecule that has been broadly studied in a number of tissues and organs, together with the creating otocyst. Nonetheless, little is thought about ceramide kinase regulation throughout inside ear improvement.
Utilizing hen otocysts, we present that genes for CERK and different enzymes of ceramide metabolism are expressed through the early levels of inside ear improvement and that CERK is developmentally regulated on the otic vesicle stage. To discover its function in inside ear morphogenesis, we blocked CERK exercise in organotypic cultures of otic vesicles with a selected inhibitor.
Inhibition of CERK exercise impaired proliferation and promoted apoptosis of epithelial otic progenitors. CERK inhibition additionally compromised neurogenesis of the acoustic-vestibular ganglion. Insulin-like progress factor-1 (IGF-1) is a key issue for proliferation, survival and differentiation within the hen otocyst.
 CERK inhibition decreased IGF-1-induced AKT phosphorylation and blocked IGF-1-induced cell survival. Total, our knowledge counsel that CERK is activated as a central component within the community of anti-apoptotic pro-survival pathways elicited by IGF-1 throughout early inside ear improvement.

The function of ceramide-1-phosphate in organic features.

In mammalian cells, cermide-1-phosphate (C1P) is produced through the ATP-dependent mechanism of changing ceramide to C1P by the enzyme, ceramide kinase (CERK). CERK was first described as a calcium-stimulated lipid kinase that co-purified with mind synaptic vesicles, and up to now, CERK is the one recognized mammalian enzyme recognized to provide C1P in cells.
C1P has steadily emerged as a bioactive sphingolipid concerned in cell proliferation, macrophage migration, and inflammatory occasions. The current era of the CERK knockout mouse and the event of CERK inhibitors have furthered our present understanding of CERK-derived C1P in regulating organic processes. On this chapter, the historical past of C1P in addition to the organic features attributed to C1P are reviewed.
 Identification of Androgen Receptor Metabolic Correlome Reveals the Repression of Ceramide Kinase by Androgens

Particular sphingolipid content material lower in Cerkl knockdown mouse retinas.

Sphingolipids (SPLs) are finely tuned structural compounds and bioactive molecules concerned in membrane fluidity and mobile homeostasis. The core sphingolipid, ceramide (CER), and its derivatives, regulate a number of essential processes in neuronal cells, amongst them cell differentiation, cell-cell interactions, membrane conductance, synaptic transmission, and apoptosis.
Mutations in Ceramide Kinase-Like (CERKL) trigger autosomal recessive Retinitis Pigmentosa and Cone Rod Dystrophy. The presence of a conserved lipid kinase area and the general similarity with CERK recommended that CERKL may play a task within the SPL metabolism as a CER kinase. Sadly, CERKL perform and substrate(s), in addition to its contribution to the retinal etiopathology, stay as but unknown.
On this work we aimed to characterize the mouse retinal sphingolipidome by UPLC-TOF to first, completely examine the SPL composition of the murine retina, evaluate it to our Cerkl -/- mannequin, and at last assess new attainable CERKL substrates by phosphorus quantification and protein-lipid overlay.
Our outcomes confirmed a constant and notable lower of the retinal SPL content material (primarily starting from 30% to 60%) within the Cerkl -/- in comparison with WT retinas, which was significantly evident within the glucosyl/galactosyl ceramide species (Glc/GalCer) whereas the phospholipids and impartial lipids remained unaltered.

CERK Antibody

1-CSB-PA898117
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CERK. Recognizes CERK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CERK Antibody

1-CSB-PA549396
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CERK. Recognizes CERK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CERK siRNA

20-abx911543
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CERK siRNA

20-abx911544
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CERK

YF-PA20581 50 ul
EUR 363
Description: Mouse polyclonal to CERK

anti-CERK

YF-PA20582 50 ug
EUR 363
Description: Mouse polyclonal to CERK

anti-CERK

YF-PA26570 50 ul
EUR 334
Description: Mouse polyclonal to CERK

CERK Rabbit pAb

A15889-100ul 100 ul
EUR 308

CERK Rabbit pAb

A15889-200ul 200 ul
EUR 459

CERK Rabbit pAb

A15889-20ul 20 ul
EUR 183

CERK Rabbit pAb

A15889-50ul 50 ul
EUR 223

CERK Conjugated Antibody

C36237 100ul
EUR 397

CERK cloning plasmid

CSB-CL005256HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atgcaacgtggccctgcttcaggtgatccgcgggaggggcctccacgccagcgccgggaaggctgctggggcctccacacctgcctcatcacggcggcgaggctacgacaatccggctgggagcatgaccttggcgtctgttctgggagcacggatgataagctctggaagctggc
  • Show more
Description: A cloning plasmid for the CERK gene.

CERK cloning plasmid

CSB-CL005256HU2-10ug 10ug
EUR 562
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1614
  • Sequence: ATGGGGGCGACGGGGGCGGCGGAGCCGCTGCAATCCGTGCTGTGGGTGAAGCAGCAGCGCTGCGCCGTGAGCCTGGAGCCCGCGCGGGCTCTGCTGCGCTGGTGGCGGAGCCCGGGGCCCGGAGCCGGCGCCCCCGGCGCGGATGCCTGCTCTGTGCCTGTATCTGAGATCATCG
  • Show more
Description: A cloning plasmid for the CERK gene.

CERK Rabbit pAb

A4935-100ul 100 ul
EUR 308

CERK Rabbit pAb

A4935-200ul 200 ul
EUR 459

CERK Rabbit pAb

A4935-20ul 20 ul Ask for price

CERK Rabbit pAb

A4935-50ul 50 ul Ask for price

Anti-CERK antibody

STJ111236 100 µl
EUR 277

Anti-CERK antibody

STJ118348 100 µl
EUR 277
Furthermore, proof in favor of CERKL binding to GlcCer, GalCer and sphingomyelin has been gathered. Altogether, these outcomes spotlight the involvement of CERKL within the SPL metabolism, query its function as a kinase, and open new situations regarding its perform.

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Post