Properties
Quality level: 100
Product line: MISSION®
Mature sequence: AUCGGGAAUGUCGUGUCCGCCC
Sanger no. Mature/minor accession:
MIMAT0001343
Sanger microRNA accession number:
MI0001448
Storage temperature: −20 ° C
General description
The individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr Hideo Iba, University of Tokyo. This algorithm uses the rugged lure design (Tue). MiRNAs are known to regulate gene expression in a number of ways, including repression of translation, mRNA cleavage, and deadenylation.
MISSION synthetic miRNA inhibitors are small double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with one miRNA binding site on each strand. Optimal inhibition of miRNA is provided after transfection due to the robust secondary structure of the inhibitor.
- Long-lasting inhibition at very low doses
- Excellent resistance to cell nucleases.
- Custom synthesis is available for a variety of species.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Other notes
Based on miRBase V19
Legal information
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
