PCTP contributes to human platelet activation by enhancing dense granule secretion

PCTP contributes to human platelet activation by enhancing dense granule secretion post thumbnail image
PCTP (phosphatidylcholine switch protein) was found just lately to control aggregation of human platelets stimulated with PAR4 activating peptide (PAR4AP). Nonetheless, the position of PCTP following thrombin stimulation, the mechanisms by which PCTP contributes to platelet activation, and the position of PCTP with different receptors remained unknown.
As mouse platelets don’t categorical PCTP, we handled human platelets with numerous agonists within the presence of the precise PCTP inhibitor A1. We noticed that PCTP inhibition considerably diminished dense granule secretion in response to thrombin, PAR1AP, PAR4AP, convulxin (GPVI agonist) and FcγRIIA crosslinking. In distinction, amongst these agonists, PCTP inhibition diminished aggregation solely to low dose thrombin and PAR4AP.
In contrast to its results on dense granule secretion, PCTP inhibition didn’t cut back alpha granule secretion in response to thrombin or PAR4AP. PCTP inhibition diminished each the rise in cytoplasmic Ca2+ in addition to PKC exercise downstream of thrombin.
These knowledge are in keeping with PCTP contributing to secretion of dense granules, and to being significantly essential to human PAR4 early signaling occasions. Future research will handle additional these molecular mechanisms and penalties for hemostasis and thrombosis.

NAD+-dependent dehydrogenase PctP and PLP-dependent aminotransferase PctC catalyze the primary post-glycosylation modification of sugar intermediate in pactamycin biosynthesis.

The distinctive five-membered aminocyclitol core of the antitumor antibiotic pactamycin originates from d-glucose, so unprecedented enzymatic modifications of the sugar intermediate are concerned within the biosynthesis. Nonetheless, the order of the modification reactions stays elusive.
Herein, we examined the timing of introduction of an amino group into sure sugar-derived intermediates through the use of recombinant enzymes that have been encoded within the pactamycin biosynthesis gene cluster. We discovered that the NAD+ -dependent alcohol dehydrogenase PctP and pyridoxal 5′-phosphate dependent aminotransferase PctC transformed N-acetyl-d-glucosaminyl-3-aminoacetophonone into 3′-amino-3′-deoxy-N-acetyl-d-glucosaminyl-3-aminoacetophenone.
Additional, N-acetyl-d-glucosaminyl-3-aminophenyl-β-oxopropanoic acid ethyl ester was transformed into the corresponding 3′-amino spinoff. Nonetheless, PctP didn’t oxidize many of the examined d-glucose derivatives, together with UDP-GlcNAc. Thus, modification of the GlcNAc moiety in pactamycin biosynthesis seems to happen after the glycosylation of aniline derivatives.

Identification of a useful genetic variant driving racially dimorphic platelet gene expression of the thrombin receptor regulator, PCTP.

Platelet activation in response to stimulation of the Protease Activated Receptor 4 (PAR4) receptor differs by race. One issue that contributes to this distinction is the expression degree of Phosphatidylcholine Switch Protein (PCTP), a regulator of platelet PAR4 operate.
Now we have performed an expression Quantitative Trait Locus (eQTL) evaluation that identifies single nucleotide polymorphisms (SNPs) linked to the expression degree of platelet genes. This evaluation revealed 26 SNPs related to the expression degree of PCTP at genome-wide significance (p < 5×10-8).
Utilizing annotation from ENCODE and different public knowledge we prioritised one in all these SNPs, rs2912553, for useful testing. The allelic frequency of rs2912553 is racially-dimorphic, in concordance with the racially differential expression of PCTP. Reporter gene assays confirmed that the only nucleotide change attributable to rs2912553 altered the transcriptional efficiency of the encompassing genomic locus.
Electromobility shift assays, luciferase assays, and overexpression research indicated a task for the megakaryocytic transcription issue GATA1. In abstract, we’ve got built-in multi-omic knowledge to determine and functionalise an eQTL. This, together with the beforehand described relationship between PCTP and PAR4 operate, permits us to characterise a genotype-phenotype relationship by the mechanism of gene expression.

Mice missing Pctp /StarD2 exhibit elevated adaptive thermogenesis and enlarged mitochondria in brown adipose tissue.

Pctp(-/-) mice that lack phosphatidylcholine switch protein (Pctp) exhibit a marked shift towards utilization of fatty acids for oxidative phosphorylation, suggesting that Pctp might regulate the entry of fatty acyl-CoAs into mitochondria. Right here, we examined the affect of Pctp expression on the operate and construction of brown adipose tissue (BAT), a mitochondrial-rich, oxidative tissue that mediates nonshivering thermogenesis.
According to elevated thermogenesis, Pctp(-/-) mice exhibited greater core physique temperatures than wild-type controls at room temperature. Throughout a 24 h chilly problem, Pctp(-/-) mice defended core physique temperature effectively sufficient that acute, full activation of BAT thermogenic genes didn’t happen.
Brown adipocytes missing Pctp harbored enlarged and elongated mitochondria. According to elevated fatty acid utilization, brown adipocytes cultured from Pctp(-/-) mice exhibited greater oxygen consumption charges in response to norepinephrine.
The absence of Pctp expression throughout brown adipogenesis in vitro altered the expression of key transcription elements, which may very well be corrected by adenovirus-mediated overexpression of Pctp early however not late throughout the differentiation. Collectively, these findings help a key position for Pctp in limiting mitochondrial oxidation of fatty acids and thus regulating adaptive thermogenesis in BAT.
 PCTP contributes to human platelet activation by enhancing dense granule secretion

Homozygous disruption of Pctp modulates atherosclerosis in apolipoprotein E-deficient mice.

Phosphatidylcholine switch protein (PC-TP) is a cytosolic phospholipid binding protein and a member of the steroidogenic acute regulatory-related switch area superfamily. Its tissue distribution consists of liver and macrophages.
PC-TP regulates hepatic lipid metabolism, and its absence in cholesterol-loaded macrophages is related to diminished ATP binding cassette transporter A1-mediated lipid efflux and elevated susceptibility to apoptosis induced by unesterified ldl cholesterol. To discover a task for PC-TP in atherosclerosis, we ready PC-TP-deficient/apolipoprotein E-deficient (Pctp(-/-)/Apoe(-/-)) mice and littermate Apoe(-/-) controls. At 16 weeks, atherosclerosis was elevated in chow-fed male, however not feminine, Pctp(-/-)/Apoe(-/-) mice.
This impact was related to will increase in plasma lipid concentrations. Against this, no variations in atherosclerosis have been noticed between male or feminine Pctp(-/-)/Apoe(-/-) mice and Apoe(-/-) controls fed a Western-type weight loss program for 16 weeks. At 24 weeks, atherosclerosis in chow-fed male Pctp(-/-)/Apoe(-/-) mice tended to be diminished in proportion to plasma ldl cholesterol.
The attenuation of atherosclerosis in feminine Pctp(-/-)/Apoe(-/-) mice fed chow or the Western-type weight loss program for 24 weeks was not attributable to modifications in plasma ldl cholesterol or triglyceride concentrations. These findings recommend that PC-TP modulates the event of atherosclerosis, partly by regulating plasma lipid concentrations.

Cloning and gene construction of rat phosphatidylcholine switch protein, Pctp.

Phosphatidylcholine switch protein (PC-TP) is a cytosolic lipid switch protein that promotes intermembrane switch of phosphatidylcholines however no different phospholipids. Though its physiological operate stays unknown, phosphatidylcholine switch protein is enriched in liver and proof from mannequin methods suggests a task in hepatocellular choice and transport of biliary phospholipids.
To facilitate in vivo research, a cDNA encoding rat PC-TP was cloned by library screening and 5′-rapid amplification of cDNA ends. Genomic cloning demonstrated the rat Pctp gene spans 10. 8kb and is comprised of six exons. The putative transcription initiation website was recognized 50bp upstream of the interpretation initiation website.

PCTP Antibody

1-CSB-PA017651LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCTP. Recognizes PCTP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PCTP siRNA

20-abx903877
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCTP siRNA

20-abx928012
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCTP siRNA

20-abx928013
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PCTP

YF-PA20318 50 ug
EUR 363
Description: Mouse polyclonal to PCTP

anti-PCTP

YF-PA20319 100 ug
EUR 403
Description: Rabbit polyclonal to PCTP

anti-PCTP

YF-PA26514 50 ul
EUR 334
Description: Mouse polyclonal to PCTP

anti-PCTP

YF-PA26515 50 ul
EUR 334
Description: Mouse polyclonal to PCTP

PCTP Conjugated Antibody

C47287 100ul
EUR 397

PCTP cloning plasmid

CSB-CL017651HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atggagctggccgccggaagcttctcggaggagcagttctgggaggcctgcgccgagctccagcagcccgctctggccggggccgactggcagctcctagtggagacctcgggcatcagcatctaccggctgctggacaagaagactggactttatgagtataaagtctttggtgt
  • Show more
Description: A cloning plasmid for the PCTP gene.

PCTP Polyclonal Antibody

A63118 100 µg
EUR 570.55
Description: Ask the seller for details

PCTP Rabbit pAb

A4904-100ul 100 ul
EUR 308

PCTP Rabbit pAb

A4904-200ul 200 ul
EUR 459

PCTP Rabbit pAb

A4904-20ul 20 ul Ask for price

PCTP Rabbit pAb

A4904-50ul 50 ul Ask for price

anti- PCTP antibody

FNab06230 100µg
EUR 585
  • Immunogen: phosphatidylcholine transfer protein
  • Uniprot ID: Q9UKL6
  • Gene ID: 58488
  • Research Area: Metabolism
Description: Antibody raised against PCTP

anti-PCTP (1F9)

LF-MA10219 100 ug
EUR 363
Description: Mouse monoclonal to PCTP

Anti-PCTP antibody

PAab06230 100 ug
EUR 412

Anti-PCTP antibody

STJ24922 100 µl
EUR 277

Anti-PCTP (1F9)

YF-MA19124 200 ul
EUR 363
Description: Mouse monoclonal to PCTP

Anti-PCTP (3A11)

YF-MA19125 50 ug
EUR 363
Description: Mouse monoclonal to PCTP

Anti-PCTP (3A11)

YF-MA19126 200 ul
EUR 363
Description: Mouse monoclonal to PCTP

PCTP Antibody, HRP conjugated

1-CSB-PA017651LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCTP. Recognizes PCTP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PCTP Antibody, FITC conjugated

1-CSB-PA017651LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCTP. Recognizes PCTP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PCTP Antibody, Biotin conjugated

1-CSB-PA017651LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCTP. Recognizes PCTP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PCTP ELISA KIT|Human

EF001620 96 Tests
EUR 689

Mouse PCTP shRNA Plasmid

20-abx971958
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PCTP shRNA Plasmid

20-abx985551
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal PCTP Antibody (Center)

APR08978G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PCTP (Center). This antibody is tested and proven to work in the following applications:

Human PCTP shRNA Plasmid

20-abx961717
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCTP Recombinant Protein (Human)

RP022816 100 ug Ask for price

PCTP Recombinant Protein (Mouse)

RP160766 100 ug Ask for price

PCTP Recombinant Protein (Rat)

RP219683 100 ug Ask for price

Phosphatidylcholine Transfer Protein (PCTP) Antibody

20-abx003727
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Phosphatidylcholine Transfer Protein (PCTP) Antibody

20-abx114433
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylcholine Transfer Protein (PCTP) Antibody

abx028941-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Nucleotide sequence evaluation of the 5′-flanking area revealed a CAAT- however no TATA-box. Transient transfection of a sequence of 5′-deleted Pctp-promoter-firefly luciferase constructs into Reuber H35 rat hepatoma cells, which categorical Pctp mRNA, and Gunn rat fibroblasts, which don’t, recommend that cis-acting parts in a 637bp promoter area contribute to enhanced expression of PC-TP in liver.

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Post