Quality level: 100 Form: buffered aqueous solution (18 ± mg / mL; pH 7.5) Specific activity ~ 2.5 units / mg protein (Approximately 2.5 U / mg (Chromozym assay); hemoglobin
Properties Quality level: 100 Product line: MISSION® Mature sequence: AUCGGGAAUGUCGUGUCCGCCC Sanger no. Mature/minor accession: MIMAT0001343 Sanger microRNA accession number: MI0001448 Storage temperature: −20 ° C General description The individual synthetic
Product details Writes: RT-qPCR Description Liferiver Novel Coronavirus (2019-nCoV) Real-Time Multiplex RT-PCR Kit is a TGA approved in vitro diagnostic (IVD) test kit. The kit is based on real-time RT-PCR
What’s Inside The PCT Start Kit? Are you interested in tissue culture but not sure where to start? The PCT Starter Kit is a PERFECT opportunity for you to test