Goat – Page 5 – Citología y Biografía de Los biólogos españoles

Cervical glandular neoplasia referrals and the diagnosis of adenocarcinoma in situ: correlating cytology, colposcopy findings and clinical outcomesCervical glandular neoplasia referrals and the diagnosis of adenocarcinoma in situ: correlating cytology, colposcopy findings and clinical outcomes

| Pedro | 0 Comment

To find out the medical outcomes of ladies with “?glandular neoplasia of endocervical kind” on cervical cytology, and to evaluation all diagnoses of cervical adenocarcinoma in situ over a 5

What is the state of the art of computer vision-assisted cytology? A Systematic Literature ReviewWhat is the state of the art of computer vision-assisted cytology? A Systematic Literature Review

| Pedro | 0 Comment

Cytology is a low-cost and non-invasive diagnostic process employed to help the prognosis of a broad vary of pathologies. Cells are harvested from tissues by aspiration or scraping, and it’s

Nieuw middel voor coronapatiënten die zelf geen antistoffen aanmakenNieuw middel voor coronapatiënten die zelf geen antistoffen aanmaken

| Pedro | 0 Comment

At the Erasmus MC in Rotterdam, the first corona patients have recently been treated with special antibodies. They do not produce enough antibodies on their own, for example, because they

ChromaFlash Chromatin Extraction KitChromaFlash Chromatin Extraction Kit

| Pedro | 0 Comment

Product description The ChromaFlash ™ Plant Chromatin Extraction Kit is a complete set of buffers and reagents optimized for isolating plant chromatin or DNA-protein complexes in a simple and fast

Proteinase K RecombinantProteinase K Recombinant

| Pedro | 0 Comment

Quality level: 100 Form: buffered aqueous solution (18 ± mg / mL; pH 7.5) Specific activity ~ 2.5 units / mg protein (Approximately 2.5 U / mg (Chromozym assay); hemoglobin

hsa-miR-425-3p miRNA Inhibitorhsa-miR-425-3p miRNA Inhibitor

| Pedro | 0 Comment

Properties Quality level: 100 Product line: MISSION® Mature sequence: AUCGGGAAUGUCGUGUCCGCCC Sanger no. Mature/minor accession: MIMAT0001343 Sanger microRNA accession number: MI0001448 Storage temperature: −20 ° C General description The individual synthetic

LiferiverLiferiver

| Pedro | 0 Comment

Product details Writes: RT-qPCR Description Liferiver Novel Coronavirus (2019-nCoV) Real-Time Multiplex RT-PCR Kit is a TGA approved in vitro diagnostic (IVD) test kit. The kit is based on real-time RT-PCR

Plant Cell TechnologyPlant Cell Technology

| Pedro | 0 Comment

What’s Inside The PCT Start Kit? Are you interested in tissue culture but not sure where to start? The PCT Starter Kit is a PERFECT opportunity for you to test